| Home Page
About Page
What's New Page
Contact Page
Favorite Links
Custom Page
Custom2 Page
Custom3 Page
Custom4 Page
Guest Book Page
|
|
Befor You Read
Have you ever heard the word DNA befor? Of course, every one has. But how much do you really know about DNA? Do you know what DNA stands for? Do you know what a gene is? Maybe you should read what's below. |
|
|
Deoxyribo Nucleic Acid
In the nucleus of every cell there are "instructions" that tell the cell what role to play in your body. These instructions form a molicule called DNA. DNA stands for DeoxyriboNucleicAcid. DNA molecules hold detailed plans, that are like the blueprints for your body. The form of DNA is in a twisted lader shap scientists call a "duble helix". The steps on the lader are made up by the four letter DNA alphabet: A, C, T & G. A always pairs with T and G always pairs with C.
The DNA starnad is mad of letters:
ATGCTCGAATAAATGTGAATTTGA
The letters make words:
ATG CTC GAA TAA ATG TGA ATT TGA
The words make sentences:
-ATG CTC GAA TAA- -ATG TGA ATT TGA-
These "sentences" are genes. Genes tell the cell to make other molecules called proteins. Proteins allow a cell to preform a spcial function, such as working w/ other groups of cells to make hearing possible.
The DNA cole letters stand for:
G: Guanine A: Adenine
T: Thymine C: Cytosine
|
|
Genes
Genes are like instruction manuals for our bodies. They are the directions for building all the proteins that make our bodies function. For instance, blood contains lots of red blood cells that transport oxygen around our bodies. the cells use a protein called "hemoglobin" to capture and carry the oxegen. Of our 40,000 genes, only a few contain the instructions for making hemoglobin proteins. The remaining genes contain the instructions for making other parts of our bodies. If our hemoglobin gene is normal, everything functions proporly. But, if the instructions in that gene are changed, or "mutated," changes in the hemoglobin protein could result. One such mutatoin causes a disorder called sickle cell anemia. Genes also contain instructoins for building proteins, which are involed in all sorts of things. Specialized proteins work in the hair cells of our ears to help us hear. Other proteins put the color in our eyes.
|
|
|